1194 Prevalence of Solobacterium moorei in Subjects With and Without Halitosis
B. CLARK1, P. MOSES1, V.I. HARASZTHY1, P.K. SREENIVASAN2, and J.J. ZAMBON1, 1State University of New York - Buffalo, Buffalo, NY, 2Colgate-Palmolive Company, Piscataway, NJ

Objectives: Oral halitosis is associated with volatile sulfur compound (VSC)-producing bacteria that colonize the dorsal surface of the tongue. Previous studies using bacterial culture have identified numerous VSC-producing species in the oral cavity including periodontal pathogens such as Porphyromonas gingivalis, Prevotella intermedia, and Tannerella forsythia as well as Veillonella and Actinomyces species. More recent studies using direct amplification of nucleic acids have identified additional species in subjects with halitosis including Dialister species, Firmicutes species, and TM7 species as well as Solobacterium moorei, a gram-positive, non-sporeforming, anaerobic bacillus originally isolated from human feces. Our previous studies suggest a close association between S. moorei and halitosis. The bacterium was identified in 8 of 8 subjects with halitosis compared to 0 of 5 control subjects. The present study examined the prevalence of S. moorei in a larger subject group. Methods: Subjects were defined as having halitosis if they had both organoleptic scores ≥ 3 as determined by a single examiner and mouth air sulfur levels of ≥250 ppb as determined by a portable sulfide detector. Control subjects were negative for both assessments. Samples were taken from an approximately 2 cm2 area of the dorsal tongue surface by gentle scraping. The samples were examined by dot blot using digoxigenin labeled oligonucleotides (AACCCCAATCCAGCCACTTAA) specific for S. moorei. Results: S. moorei was detected in all 21 subjects with halitosis and in 4 of 29 control subjects. These 4 control subjects each had chronic periodontitis. Direct amplification of nucleic acids from tongue samples taken from one subject with extremely high mouth air sulfur levels (1900 ppb) identified S. moorei by sequence analysis from 3 of 134 randomly selected clones as well as Atopobium, Catonella, Megasphaera, Mogibacterium, Ruminococcus, and Veillonella species. Conclusion: This report confirms previous studies associating S. moorei with oral halitosis.

Seq #170 - Microbiology
10:45 AM-12:00 PM, Saturday, April 5, 2008 Hilton Anatole Hotel Trinity I - Exhibit Hall

Back to the Microbiology / Immunology and Infection Control Program
Back to the AADR 37th Annual Meeting and Exhibition

Top Level Search